ndufv1

Ensembl ID:
ENSDARG00000036438
ZFIN ID:
ZDB-GENE-040808-73
Description:
NADH dehydrogenase [Source:RefSeq peptide;Acc:NP_001003747]
Human Orthologue:
NDUFV1
Human Description:
NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa [Source:HGNC Symbol;Acc:7716]
Mouse Orthologue:
Ndufv1
Mouse Description:
NADH dehydrogenase (ubiquinone) flavoprotein 1 Gene [Source:MGI Symbol;Acc:MGI:107851]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43227 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43227
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052930 Essential Splice Site 336 492 None 11

The following transcripts of ENSDARG00000036438 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 9845515)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9304054
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAAGAGATGTCCATTCCCCTTAAAGAGCTTATCGAAAGACATGCAGG[T/C]ACACCTCAGGCCAGCCGCTAGTGGTATACCACCTATAGGATACACCCCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link