Q4V8Q9_DANRE

Ensembl ID:
ENSDARG00000036433
Description:
LOC100004902 protein [Source:UniProtKB/TrEMBL;Acc:Q4V8Q9]
Human Orthologue:
ERP27
Human Description:
endoplasmic reticulum protein 27 [Source:HGNC Symbol;Acc:26495]
Mouse Orthologue:
Erp27
Mouse Description:
endoplasmic reticulum protein 27 Gene [Source:MGI Symbol;Acc:MGI:1916437]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20603 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20603
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053700 Nonsense 42 78 1 2
Genomic Location (Zv9):
Chromosome 6 (position 117643)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150680.1 2533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGATCTCCCCCGGGTCGGCCTTTATGACGTCACGCTGGACCAGAAGTG[G/A]CTGATGGCGGCGGGAGAGATCACTACTGAGCGCGTGCAGAACTTCTGCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link