LOC100007362

Ensembl ID:
ENSDARG00000036424
Human Orthologue:
PCDH20
Human Description:
protocadherin 20 [Source:HGNC Symbol;Acc:14257]
Mouse Orthologue:
Pcdh20
Mouse Description:
protocadherin 20 Gene [Source:MGI Symbol;Acc:MGI:2443376]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35160 Nonsense Mutation detected in F1 DNA During 2017
sa35159 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35160
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052912 Nonsense 316 881 2 2
Genomic Location (Zv9):
Chromosome 11 (position 43998181)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42624696
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGGGTCAGCCAGGAAAGCAAAAGCTTATTTCACTTGGATACAACGACT[G/T]GAGTTCTGAAACTAGCAGGAAAGATCAACAACAACAGTGCGAAGCTATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35159
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052912 Nonsense 740 881 2 2
Genomic Location (Zv9):
Chromosome 11 (position 43996909)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42623424
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAGAGAACTGACGGAGAACCAGGGTCGTTTGACATCGATCCGTACACT[G/T]GAAACATCACCCTGAGGAAAGCCTTGAACAGTCGGGGGCTTTATAGTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Asthma: Identification of IL6R and chromosome 11q13.5 as risk loci for asthma. (View Study)
  • Longevity: Joint influence of small-effect genetic variants on human longevity. (View Study)
  • Schizophrenia: Genome-wide association study of clinical dimensions of schizophrenia: polygenic effect on disorganized symptoms. (View Study)
  • Sphingolipid levels: Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link