ENSDARG00000036420

Ensembl ID:
ENSDARG00000036420
Human Orthologues:
ABR, BCR
Human Descriptions:
active BCR-related gene [Source:HGNC Symbol;Acc:81]
breakpoint cluster region [Source:HGNC Symbol;Acc:1014]
Mouse Orthologues:
Abr, Bcr
Mouse Descriptions:
active BCR-related gene Gene [Source:MGI Symbol;Acc:MGI:107771]
breakpoint cluster region Gene [Source:MGI Symbol;Acc:MGI:88141]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10997 Nonsense Available for shipment Available now
sa15342 Nonsense Available for shipment Available now
sa25359 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20906 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10997
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052906 Nonsense 14 828 1 22
Genomic Location:
Chromosome 7 (position 21551065)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTGCTGATGGAGCTCTTTTCTGAGRCTGTGGAATATCTGAAGRCYTA[T/A]GGCATCTCACCTGGTACCACTGTTTTGTTTRATAGTAACTACACMAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15342
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052906 Nonsense 297 828 9 22
Genomic Location:
Chromosome 7 (position 21560531)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WCTTTAAAAYGAATCATCATATATGCAWGTGTGCATGTCTGCAGAGACGT[C/T]AACTGATGCGTGATGGGTTTGTGGTTGATGTGTGTGAAAGTGGGCACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25359
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052906 Essential Splice Site 576 828 16 22
Genomic Location:
Chromosome 7 (position 21570346)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACGAGAATGACACACAGAACGACATCGTGGGCAGAACAGTCTTAAATG[T/C]GAGTATATGAACTCTAGCCCTAAATTTGTAAAGTCAAGAAAAAGATTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20906
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052906 Essential Splice Site 759 828 21 22
Genomic Location:
Chromosome 7 (position 21577431)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTACTCTAGCCTGACCTCATCTCACATCTGACCTTTTTGCATTCTTC[A/T]GAGTTGCAGAGAGGAAGGAAGAGAATAAAATGTCCTTGAGTAATTTGGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3sk52pmj