glb1

Ensembl ID:
ENSDARG00000036415
ZFIN ID:
ZDB-GENE-050410-9
Description:
beta-galactosidase [Source:RefSeq peptide;Acc:NP_001017547]
Human Orthologue:
GLB1
Human Description:
galactosidase, beta 1 [Source:HGNC Symbol;Acc:4298]
Mouse Orthologue:
Glb1
Mouse Description:
galactosidase, beta 1 Gene [Source:MGI Symbol;Acc:MGI:88151]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8423 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24857 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3363 Nonsense Mutation detected in F1 DNA During 2014
sa18711 Nonsense Mutation detected in F1 DNA During 2014
sa11023 Nonsense Available for shipment Available now
sa19602 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8423
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033761 Essential Splice Site 126 651 3 17
ENSDART00000124682 Essential Splice Site 151 676 3 16
ENSDART00000136942 Essential Splice Site 126 651 3 16
Genomic Location:
Chromosome 1 (position 52960118)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGGTYATCATGAGACCAGGACCCTACATATGTGCCGAGTGGGATATG[G/A]TGAGAAAACACTGTACTTTCTATAGGCAGRGAATRTATGTTAGGATAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24857
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033761 Essential Splice Site 126 651 3 17
ENSDART00000124682 Essential Splice Site 151 676 3 16
ENSDART00000136942 Essential Splice Site 126 651 3 16
Genomic Location:
Chromosome 1 (position 52960119)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGTCATCATGAGACCAGGACCCTACATATGTGCCGAGTGGGATATGG[T/G]GAGAAAACACTGTACTTTCTATAGGCAGAGAATATATGTTAGGATAGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3363
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033761 Nonsense 204 651 6 17
ENSDART00000124682 Nonsense 229 676 6 16
ENSDART00000136942 Nonsense 204 651 6 16
Genomic Location:
Chromosome 1 (position 52962349)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTGTGATTTTAACTACATGCGTCATCTGAGCCAGTTGTTCCGGTTTTA[T/A]CTCGGGGAAGAGGCTGTGCTGTTCACTACTGATGGGGCAGGTCTGGGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18711
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033761 Nonsense 325 651 10 17
ENSDART00000124682 Nonsense 350 676 10 16
ENSDART00000136942 Nonsense 325 651 10 16
ENSDART00000033761 Nonsense 325 651 10 17
ENSDART00000124682 Nonsense 350 676 10 16
ENSDART00000136942 Nonsense 325 651 10 16
Genomic Location:
Chromosome 1 (position 52964743)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCACATTATAGGTGCCAACACTCCTTATGGTCCTCAACCCACCAGCTA[T/G]GACTATGACTCTCCTCTTACAGAGGCTGGAGATCTCACTGAGAAATATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11023
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033761 Nonsense 325 651 10 17
ENSDART00000124682 Nonsense 350 676 10 16
ENSDART00000136942 Nonsense 325 651 10 16
ENSDART00000033761 Nonsense 325 651 10 17
ENSDART00000124682 Nonsense 350 676 10 16
ENSDART00000136942 Nonsense 325 651 10 16
Genomic Location:
Chromosome 1 (position 52964743)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCACATTATAGGTGCCAACACTCCTTATGGTCCTCAACCCACCAGCTA[T/G]GACTATGACTCTCCTCTTACAGAGGCTGGAGATCTCACWGAGAAATATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19602
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033761 Nonsense 648 651 16 17
ENSDART00000124682 Nonsense 673 676 16 16
ENSDART00000136942 Nonsense 648 651 16 16
Genomic Location:
Chromosome 1 (position 52973106)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTAAACGGCACCGTGAACGGCCAATACAAGAGACAACTATTCAACAAA[C/T]AAGACCTCTTTTGAGTTTACAGCCGCTTCCAGTTGCAGAAATTGTTTATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/noc97wi5