LOC569602

Ensembl ID:
ENSDARG00000036414
Mouse Orthologue:
Irs3
Mouse Description:
insulin receptor substrate 3 Gene [Source:MGI Symbol;Acc:MGI:1194882]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20903 Nonsense Mutation detected in F1 DNA During 2014
sa10062 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20903
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011398 Nonsense 708 1245 2 3
Genomic Location:
Chromosome 7 (position 21332620)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATGTCACCCATAAGTGCTCGGTCTGCCAATAGTACTCCACCCCCACCC[G/T]AGCCCCACACTCCATCTGACCAGCATTCTAATCAGCCTCAACCGAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10062
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011398 Nonsense 927 1245 2 3
Genomic Location:
Chromosome 7 (position 21333277)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCACTTACCTAGGCCAACCTCTTGTGTTGCCGGGTTCTTACAATTCTCA[C/T]AAAGCTCCTCCACCCCAATTCCTCCATCAACTGCCTCTGAGTATGTCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6o6m4gmp