LOC569602

Ensembl ID:
ENSDARG00000036414
Mouse Orthologue:
Irs3
Mouse Description:
insulin receptor substrate 3 Gene [Source:MGI Symbol;Acc:MGI:1194882]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34038 Nonsense Mutation detected in F1 DNA During 2016
sa40865 Nonsense Mutation detected in F1 DNA During 2016
sa20903 Nonsense Available for shipment Available now
sa10062 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34038
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011398 Nonsense 122 1245 2 3
Genomic Location (Zv9):
Chromosome 7 (position 21330862)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19921298
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATACTGACGTGTTTGTTTTCTCTTGCTCTACAGGTAAGGCACTGTGT[G/T]AGAATGCGAATGGAGGAGACTACGGAGTACCATCCCCTGGTCCTGCCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40865
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011398 Nonsense 262 1245 2 3
Genomic Location (Zv9):
Chromosome 7 (position 21331283)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19921719
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCAAGTCACAGTCAACTGCTGCAGGAGCAGGAGGTGGCACCACTGCAT[C/A]AAATCCCATCAGTGTTCCGTCTCGACGCCATCACCCGAATCCTCCACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20903
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011398 Nonsense 708 1245 2 3
Genomic Location (Zv9):
Chromosome 7 (position 21332620)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19923056
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATGTCACCCATAAGTGCTCGGTCTGCCAATAGTACTCCACCCCCACCC[G/T]AGCCCCACACTCCATCTGACCAGCATTCTAATCAGCCTCAACCGAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10062
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011398 Nonsense 927 1245 2 3
Genomic Location (Zv9):
Chromosome 7 (position 21333277)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19923713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCACTTACCTAGGCCAACCTCTTGTGTTGCCGGGTTCTTACAATTCTCA[C/T]AAAGCTCCTCCACCCCAATTCCTCCATCAACTGCCTCTGAGTATGTCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link