Q502M3_DANRE

Ensembl ID:
ENSDARG00000036402
Description:
LOC553451 protein [Source:UniProtKB/TrEMBL;Acc:Q502M3]
Human Orthologue:
SPTBN1
Human Description:
spectrin, beta, non-erythrocytic 1 [Source:HGNC Symbol;Acc:11275]
Mouse Orthologue:
Spnb2
Mouse Description:
spectrin beta 2 Gene [Source:MGI Symbol;Acc:MGI:98388]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5848 Nonsense Mutation detected in F1 DNA During 2017
sa41918 Nonsense Mutation detected in F1 DNA During 2017
sa21982 Nonsense Available for shipment Available now
sa15290 Nonsense Available for shipment Available now
sa35163 Nonsense Mutation detected in F1 DNA During 2017
sa21981 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa5848
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098492 Nonsense 327 1416 8 22
Genomic Location (Zv9):
Chromosome 11 (position 44169948)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42895359
KASP Assay ID:
554-3770.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCATCATCCTCAATAACCGCAAGTTTGCAAACTCTCTGGTTGGAGTC[C/T]AGCAGCAGCTTCWGGCCTTCAACACCTACAGGACCGTAGAGAAACCACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098492 Nonsense 499 1416 11 22
Genomic Location (Zv9):
Chromosome 11 (position 44165957)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42891368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGATATCAAGCGAATCACAGCGCGCAAAGACAACGTGCTGCGGCTGTG[G/A]GAGTATCTGCTGGAGCTGCTGAAGGCCCGCAGGCAGAGGCTGGAGATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21982
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098492 Nonsense 614 1416 13 22
Genomic Location (Zv9):
Chromosome 11 (position 44162089)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42887500
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCCGTGACCGTGTGGCCCACATGGAGTTCTGCTATCAAGAACTGACA[C/T]AGCTCGCAGCCGAACGCCGCGCTCGTCTAGAAGAGTCCCGCCGCCTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15290
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098492 Nonsense 666 1416 13 22
Genomic Location (Zv9):
Chromosome 11 (position 44161932)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42887343
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTATCCTCCGACGACTGYGGGAAGGATCTAACCGGCGCCGTGCGTCTTT[T/A]AAGCCAACATCGTGCTCTGGAAGACGAAATGAGCGGTYGTTCTGGACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35163
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098492 Nonsense 1150 1416 15 22
Genomic Location (Zv9):
Chromosome 11 (position 44153224)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42878635
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGGCGCTGGACACCGGCTGGAATGAGCTTCACAAGATGTGGGAGAAC[C/T]GACAGAACCTGCTGTCTCAGTCTCACGCCTACCAGATCTTCCTCAGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21981
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098492 Essential Splice Site 1245 1416 16 22
Genomic Location (Zv9):
Chromosome 11 (position 44150164)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42875575
KASP Assay ID:
2260-4699.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATTAACGCTGACCGCATACAAGAGCGTGCAGCCTCCATTGATGACCG[G/A]TAACAAGACACCACTGTTGGGTGCCATTACTTCCCAACTATCTAGTTACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link