dync1li1

Ensembl ID:
ENSDARG00000036387
ZFIN ID:
ZDB-GENE-030131-4108
Description:
cytoplasmic dynein 1 light intermediate chain 1 [Source:RefSeq peptide;Acc:NP_001095898]
Human Orthologue:
DYNC1LI1
Human Description:
dynein, cytoplasmic 1, light intermediate chain 1 [Source:HGNC Symbol;Acc:18745]
Mouse Orthologue:
Dync1li1
Mouse Description:
dynein cytoplasmic 1 light intermediate chain 1 Gene [Source:MGI Symbol;Acc:MGI:2135610]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14756 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14756
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052859 Nonsense 280 501 7 13
ENSDART00000112812 Nonsense 280 491 7 13

The following transcripts of ENSDARG00000036387 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 18594323)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19439558
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACTACTCTACACATCCATGAAGGAGAACAAGAATCKAGACTTGTTATA[T/G]AAATACCTCGTTCACAGGYTATATGGCTTTCCGTTCAACAGCCCAGCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link