rbm4.1

Ensembl ID:
ENSDARG00000036386
ZFIN ID:
ZDB-GENE-030131-3902
Description:
RNA-binding protein 4.1 [Source:UniProtKB/Swiss-Prot;Acc:Q6IQ97]
Human Orthologues:
RBM4, RBM4B, RP11-658F2.1
Human Descriptions:
RNA binding motif protein 4 [Source:HGNC Symbol;Acc:9901]
RNA binding motif protein 4B [Source:HGNC Symbol;Acc:28842]
RNA-binding protein 4 isoform 1 [Source:RefSeq peptide;Acc:NP_002887]
Mouse Orthologue:
Rbm4b
Mouse Description:
RNA binding motif protein 4B Gene [Source:MGI Symbol;Acc:MGI:1913954]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2347 Nonsense Available for shipment Available now
sa9445 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2347
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052862 Nonsense 120 419 2 4

The following transcripts of ENSDARG00000036386 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 23970612)
KASP Assay ID:
554-2517.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGGTTGAGTGCGATATTGTGAAGGACTATGCTTTTGTTCACATGGAG[C/T]GAGTGGAAGATGCTATGGAAGCCATCAGTGGCTTGGACAACACAGCCTTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa9445
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052862 Nonsense 417 419 3 4

The following transcripts of ENSDARG00000036386 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 23973139)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGCTGCGTATGACGTGCCGCGGGAYCCATACGCTGAAYGGGCGCGCTA[T/A]GCTTACTAGCCTAATTCCTGTGCGCACTCAGGTGAGATCTTTTTAGGATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p5mdjkaz