si:ch73-335m24.5

Ensembl ID:
ENSDARG00000036383
ZFIN ID:
ZDB-GENE-100922-39
Human Orthologues:
SLC24A3, SLC24A4
Human Descriptions:
solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 [Source:HGNC Symbol;Acc:1097
solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 [Source:HGNC Symbol;Acc:1097
Mouse Orthologues:
Slc24a3, Slc24a4
Mouse Descriptions:
solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 Gene [Source:MGI Symbol;Acc:
solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 Gene [Source:MGI Symbol;Acc:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17884 Essential Splice Site Available for shipment Available now
sa28338 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa17884
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112438 Essential Splice Site 235 621 8 16
Genomic Location (Zv9):
Chromosome 14 (position 34867874)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 33575863
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTTGTTTRTGTGTATTTCAGATCATATATGATGAAAAAGTAATCTGG[T/C]GAGTGTGGYTGAGAAGCTGTAAYAATAATTATTTACATTTWAGTGAAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112438 Essential Splice Site 563 621 14 16
Genomic Location (Zv9):
Chromosome 14 (position 34881065)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 33562672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTTTCCATGGGCTTTGCGCACCCTAGTGGTTGATTATGGCTCAACTG[T/A]GAGTTTATATTTGTGTGTATATGCGGTTACTGATATTAATTTCTCTAACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link