NP_001091056.1

Ensembl ID:
ENSDARG00000036375
Description:
cytoplasmic FMR1-interacting protein 2 [Source:RefSeq peptide;Acc:NP_001091056]
Human Orthologue:
CYFIP2
Human Description:
cytoplasmic FMR1 interacting protein 2 [Source:HGNC Symbol;Acc:13760]
Mouse Orthologue:
Cyfip2
Mouse Description:
cytoplasmic FMR1 interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1924134]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa642 Essential Splice Site F2 line generated During 2014
sa16828 Nonsense Available for shipment Available now
sa1556 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa642
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020014 Essential Splice Site 300 1253 9 29
ENSDART00000123607 Essential Splice Site 300 1253 9 30
Genomic Location:
Chromosome 14 (position 35099682)
KASP Assay ID:
554-0551.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGATGCCAAGAAAAGGATAAACCTCAGCAAAATCGACAAGTTCTTCAAG[G/T]TGAAACCAAACTACCCGGTTCTCATKAGGACCGTTTTCATTTTNGGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16828
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020014 Nonsense 702 1253 17 29
ENSDART00000123607 Nonsense 702 1253 17 30
Genomic Location:
Chromosome 14 (position 35087014)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGTTTCTTCTTCATTTYAGGTCAACCTGTGTTTTGATCAGTTTGTGTA[C/A]AAGTTAGCTGACCAGATATTTGCCTACTACAAAGCAATGGCTGGAAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1556
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020014 Nonsense 750 1253 18 29
ENSDART00000123607 Nonsense 750 1253 18 30
Genomic Location:
Chromosome 14 (position 35086400)
KASP Assay ID:
554-1499.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGATCATCCCATACCCGCCAWCAAACCGCTACGAGACGCTGCTGAAA[C/T]AGAGACATGTGCAGGTTTGAGCTAACATTTGAATGGCCAACTCAAAATGT
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Entity Quality Tag
Larval:Day 5
ZFS:0000037
larval locomotory behavior
GO:0008345

disrupted
PATO:0001507
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
swim bladder
ZFA:0000076

aplastic
PATO:0001483
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
anterior/posterior axis
BSPO:0000013
decreased length
PATO:0000574
abnormal
PATO:0000460
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
23:31883130-31883300 31883130 -1 3.44 × 10-17 -1.5 -17 sgk1 ENSDARG00000025522
5:46432652-46433000 46432652 -1 2.84 × 10-16 2.0 -6 fbp2 ENSDARG00000012366
1:57116382-57117100 57116382 -1 1.15 × 10-14 1.1 0 wu:fa03e10 ENSDARG00000088636
4:12642190-12643300 12642190 -1 7.77 × 10-11 0.6 0 opn1sw1 ENSDARG00000045677
19:5963568-5963900 5963568 -1 2.47 × 10-09 -1.5 -1 si:dkeyp-113d7.4 ENSDARG00000090268

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jo8dvnec