acta1a

Ensembl ID:
ENSDARG00000036371
ZFIN ID:
ZDB-GENE-050417-267
Description:
actin, alpha 1a, skeletal muscle [Source:RefSeq peptide;Acc:NP_001017750]
Human Orthologue:
ACTA1
Human Description:
actin, alpha 1, skeletal muscle [Source:HGNC Symbol;Acc:129]
Mouse Orthologue:
Acta1
Mouse Description:
actin, alpha 1, skeletal muscle Gene [Source:MGI Symbol;Acc:MGI:87902]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19610 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18713 Nonsense Mutation detected in F1 DNA During 2014
sa9336 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19610
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052838 Essential Splice Site 269 377 5 7

The following transcripts of ENSDARG00000036371 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 54517165)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGAGCGTTTCCGTTGCCCTGAGACCCTCTTCCAGCCTTCCTTCATTG[G/A]TATGTTGTCTGAAAACATCGAACGTCATCAGTTGCCTTGCGTTTTAGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18713
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052838 Nonsense 322 377 6 7
ENSDART00000052838 Nonsense 322 377 6 7

The following transcripts of ENSDARG00000036371 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 54517601)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGATGTACCCTGGTATTGCTGACCGCATGCAGAAGGAAATCACAGCTT[T/A]GGCTCCAAGCACAATGAAGATTAAGGTAACAGAGACGTGAAATAGTAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9336
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052838 Nonsense 322 377 6 7
ENSDART00000052838 Nonsense 322 377 6 7

The following transcripts of ENSDARG00000036371 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 54517601)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACGATGTACCCTGGTATTGCTGACCGCATGCAGAAGGAAATCACAGCTT[T/A]GGCTCCAAGCACAATGAAGATWAAGGTAACAGAGAMGTGAWATAGTAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uwhng78u