ftsjd1

Ensembl ID:
ENSDARG00000036345
ZFIN ID:
ZDB-GENE-040426-2775
Description:
FtsJ methyltransferase domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVS8]
Human Orthologue:
FTSJD1
Human Description:
FtsJ methyltransferase domain containing 1 [Source:HGNC Symbol;Acc:25635]
Mouse Orthologue:
Ftsjd1
Mouse Description:
FtsJ methyltransferase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2384580]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20930 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20930
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052805 Nonsense 316 743 2 2
Genomic Location:
Chromosome 7 (position 25883598)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGCTCCGTGAACATCTTCAAGCCAGGCACCAGCAAGTCTGGAAACTCA[G/T]AATTGTATATAGTGTGCTTGGACTATCAGGCCAAAGAACAAATTCGGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4682yeo8