LOC100330810

Ensembl ID:
ENSDARG00000036308
Human Orthologue:
NOD1
Human Description:
nucleotide-binding oligomerization domain containing 1 [Source:HGNC Symbol;Acc:16390]
Mouse Orthologue:
Nod1
Mouse Description:
nucleotide-binding oligomerization domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1341839]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12613 Nonsense Available for shipment Available now
sa28761 Nonsense Mutation detected in F1 DNA During 2015
sa17969 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12613
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052749 Nonsense 566 947 3 11
Genomic Location:
Chromosome 16 (position 57299257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCRTCACGTCTCTCCTGCATACCTTGCCTAAAAAACACAAAACCCAGA[G/T]AGAGCGATGCATTCCAGACCAACTTTCAATTCACTAATCTATTCCTGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28761
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052749 Nonsense 670 947 3 11
Genomic Location:
Chromosome 16 (position 57298943)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGCGAGGACGTGGCCAAGATGACAGCTAACGGCATATCTGCAGATTA[T/A]ATTAAGATTGCGTTCTGTAATATTTACTCTGCCGACTGCAGTGCTTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17969
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052749 Essential Splice Site 784 947 5 11
Genomic Location:
Chromosome 16 (position 57296359)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACAAGTAGCAAAGATCATTGAAGAATGTCCACATTTGAGGACYGTCAA[G/A]TGAGTAAACCAGGAATAAACCCTCGCAGAACAAAAACACTSCTGRCGGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jl1szraa