LOC100330810

Ensembl ID:
ENSDARG00000036308
Human Orthologue:
NOD1
Human Description:
nucleotide-binding oligomerization domain containing 1 [Source:HGNC Symbol;Acc:16390]
Mouse Orthologue:
Nod1
Mouse Description:
nucleotide-binding oligomerization domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1341839]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12613 Nonsense Available for shipment Available now
sa17969 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12613
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052749 Nonsense 566 947 3 11
Genomic Location:
Chromosome 16 (position 57299257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCRTCACGTCTCTCCTGCATACCTTGCCTAAAAAACACAAAACCCAGA[G/T]AGAGCGATGCATTCCAGACCAACTTTCAATTCACTAATCTATTCCTGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17969
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052749 Essential Splice Site 784 947 5 11
Genomic Location:
Chromosome 16 (position 57296359)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACAAGTAGCAAAGATCATTGAAGAATGTCCACATTTGAGGACYGTCAA[G/A]TGAGTAAACCAGGAATAAACCCTCGCAGAACAAAAACACTSCTGRCGGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jl1szraa