phf23b

Ensembl ID:
ENSDARG00000036305
ZFIN IDs:
ZDB-GENE-030131-5895, ZDB-GENE-030131-5895
Description:
PHD finger protein 23B [Source:UniProtKB/Swiss-Prot;Acc:Q7SXB5]
Human Orthologue:
PHF23
Human Description:
PHD finger protein 23 [Source:HGNC Symbol;Acc:28428]
Mouse Orthologue:
Phf23
Mouse Description:
PHD finger protein 23 Gene [Source:MGI Symbol;Acc:MGI:1925496]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20948 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20948
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037087 Essential Splice Site 51 297 3 6
ENSDART00000126626 Essential Splice Site 51 315 3 5
Genomic Location (Zv9):
Chromosome 7 (position 27751295)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26354234
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGCAGTTTTGTTCTTGCCTATGCCAATTACATCCCATCTCAAAAGGAG[G/A]TAAGAATGGAGCAAGTTTAGGTGTGATTATTATTATTATTTTTTAACTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link