nucb2a

Ensembl ID:
ENSDARG00000036299
ZFIN ID:
ZDB-GENE-030826-14
Description:
nucleobindin 2a [Source:RefSeq peptide;Acc:NP_958901]
Human Orthologue:
NUCB2
Human Description:
nucleobindin 2 [Source:HGNC Symbol;Acc:8044]
Mouse Orthologue:
Nucb2
Mouse Description:
nucleobindin 2 Gene [Source:MGI Symbol;Acc:MGI:1858179]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16703 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16703
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052731 Essential Splice Site 127 496 4 13
Genomic Location (Zv9):
Chromosome 7 (position 28162996)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26765935
KASP Assay ID:
2259-8877.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGCCTGAGAACCCTGATCAAGGCCAAGCAAGACATCGAAGGAGGRAACG[G/A]TAAGATTTAANNGTAAMWGTAAACAGTTTACAGTAAAAGTAAACTGAATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link