gnb1l

Ensembl ID:
ENSDARG00000036293
ZFIN ID:
ZDB-GENE-050320-77
Description:
guanine nucleotide-binding protein subunit beta-like protein 1 [Source:RefSeq peptide;Acc:NP_001013
Human Orthologue:
GNB1L
Human Description:
guanine nucleotide binding protein (G protein), beta polypeptide 1-like [Source:HGNC Symbol;Acc:4397
Mouse Orthologue:
Gnb1l
Mouse Description:
guanine nucleotide binding protein (G protein), beta polypeptide 1-like Gene [Source:MGI Symbol;Acc:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1418 Nonsense Available for shipment Available now
sa20363 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1418
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052712 Nonsense 57 323 3 7

The following transcripts of ENSDARG00000036293 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 16967211)
KASP Assay ID:
554-1339.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTGCRGTCCATGYGTGGAACCTGAGCACCAGGAGAGCAGAACGTGTTT[T/A]AGAGAGCCATGCTGGGAACTCTGTAATCTGGCTTAACACCTTCAACAACA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa20363
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052712 Nonsense 176 323 6 7

The following transcripts of ENSDARG00000036293 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 16939106)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTTTCTTTCTCCTCAGGCTGATTCTGGTCCAGTTCTATGTGCCGGTTA[T/A]GAGGATGGCTCGGTGGTATTATGGGATGTTTCTCATCGCCGTCCATTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p3du7ktx