CC2D1A

Ensembl ID:
ENSDARG00000036281
Description:
coiled-coil and C2 domain containing 1A [Source:HGNC Symbol;Acc:30237]
Human Orthologue:
CC2D1A
Human Description:
coiled-coil and C2 domain containing 1A [Source:HGNC Symbol;Acc:30237]
Mouse Orthologue:
Cc2d1a
Mouse Description:
coiled-coil and C2 domain containing 1A Gene [Source:MGI Symbol;Acc:MGI:2384831]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9244 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9244
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110818 Essential Splice Site 973 1000 27 28
Genomic Location:
Chromosome 1 (position 55755415)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAATYCTTCATTATTTAACCAAAGCTCAAAAACTGCTGTTGTTGTTCTC[A/C]GGAAGCAGCAAAAGACGCCCTCGGCCGACTGAAGATGGTGGAGAACGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kogfwsfq