CC2D1A

Ensembl ID:
ENSDARG00000036281
Description:
coiled-coil and C2 domain containing 1A [Source:HGNC Symbol;Acc:30237]
Human Orthologue:
CC2D1A
Human Description:
coiled-coil and C2 domain containing 1A [Source:HGNC Symbol;Acc:30237]
Mouse Orthologue:
Cc2d1a
Mouse Description:
coiled-coil and C2 domain containing 1A Gene [Source:MGI Symbol;Acc:MGI:2384831]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44517 Essential Splice Site Mutation detected in F1 DNA During 2017
sa9244 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44517
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110818 Essential Splice Site 616 1000 15 28
Genomic Location (Zv9):
Chromosome 1 (position 55767852)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAAACGCAGACTTAGTTTACTCTCTAAATGATGAATGTGTGTTTTGC[A/G]GAAATGTCTGGCCTACTCGCAGCAGTTCACTCACATGGGGAACATAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9244
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110818 Essential Splice Site 973 1000 27 28
Genomic Location (Zv9):
Chromosome 1 (position 55755415)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 54538322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAATYCTTCATTATTTAACCAAAGCTCAAAAACTGCTGTTGTTGTTCTC[A/C]GGAAGCAGCAAAAGACGCCCTCGGCCGACTGAAGATGGTGGAGAACGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link