lamc1

Ensembl ID:
ENSDARG00000036279
ZFIN ID:
ZDB-GENE-021226-3
Description:
Laminin subunit gamma-1 [Source:UniProtKB/Swiss-Prot;Acc:Q1LVF0]
Human Orthologue:
LAMC1
Human Description:
laminin, gamma 1 (formerly LAMB2) [Source:HGNC Symbol;Acc:6492]
Mouse Orthologue:
Lamc1
Mouse Description:
laminin, gamma 1 Gene [Source:MGI Symbol;Acc:MGI:99914]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa379 Essential Splice Site Available for shipment Available now
sa19814 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18732 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2080 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9866 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa379
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004277 Essential Splice Site 325 1593 5 28
Genomic Location:
Chromosome 2 (position 35675287)
KASP Assay ID:
554-0359.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATATTTTTTATAGGCACATTTTCTGACTGGTGTTTGTGTGTGTGTTTCA[G/A]CTTGTAACTGTAATGGAAAGAGCGCTGAATGTTACTTCGACCCTGAGCTG
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control; 24 hpf

Control; 24 hpf

zoom

Mutant; 24 hpf

Mutant; 24 hpf

zoom

Stage Entity Quality Tag
Pharyngula:Prim-5
ZFS:0000029
brain
ZFA:0000008
quality
PATO:0000001
abnormal
PATO:0000460
Pharyngula:Prim-5
ZFS:0000029
extension
ZFA:0000106
quality
PATO:0000001
abnormal
PATO:0000460
Pharyngula:Prim-5
ZFS:0000029
eye
ZFA:0000107
quality
PATO:0000001
abnormal
PATO:0000460
Pharyngula:Prim-5
ZFS:0000029
notochord development
GO:0030903
disrupted
PATO:0001507
abnormal
PATO:0000460
Pharyngula:Prim-5
ZFS:0000029
somite
ZFA:0000155
quality
PATO:0000001
abnormal
PATO:0000460
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
1:4393283-4394100 4393283 -1 1.59 × 10-185 3.4 0 fn1b ENSDARG00000006526
13:39679457-39680000 39679457 -1 9.83 × 10-126 -1.7 12 col9a1 ENSDARG00000031483
1:54519801-54520283 54520283 1 5.21 × 10-46 -1.0 -3 acta1a ENSDARG00000036371
21:38029201-38029552 38029552 1 1.23 × 10-45 -1.3 3 cryba1b ENSDARG00000053875
12:37046025-37046400 37046025 -1 1.86 × 10-45 3.2 -2 socs3b ENSDARG00000026611

Mutation Details

Allele Name:
sa19814
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004277 Essential Splice Site 427 1593 7 28
Genomic Location:
Chromosome 2 (position 35676756)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGACACTTCTGAAATTGCTGTGTCTAAAGATTCCTCTTTTTCTCTTCAC[A/T]GACCGTGCTCTTGTAATCCAGCCGGAAGCACACAGGAGTGTGATGTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18732
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004277 Essential Splice Site 867 1593 14 28
ENSDART00000004277 Essential Splice Site 867 1593 14 28
Genomic Location:
Chromosome 2 (position 35689761)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTTCTACGGTGATGCCCGCGCTGCTAATGTAGCCGACAAATGCAAACG[T/A]GAGTGAAAGGAGAACGAAATATCTGTACTTGGTTTTTTGTTGTTGATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004277 Essential Splice Site 867 1593 14 28
ENSDART00000004277 Essential Splice Site 867 1593 14 28
Genomic Location:
Chromosome 2 (position 35689761)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTTCTAYGGTGATGCCCGCGCTGCTAATGTAGCCGACAAATGCAAACG[T/A]RAGTGAAAGGAGAACGAAATATCTGTACTTGGTTTTTTGTTGTTGATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9866
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004277 Nonsense 969 1593 17 28
Genomic Location:
Chromosome 2 (position 35692130)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGGTTTTCCTGCGTTGACGCTTGGAATGTTTGTACAGCATGTGACTG[T/A]GACCCAGAAGGCTCAGAATCAGCTCAGTGTAARGAGGACGGCCGCTGTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ovoumnek