LOC565237

Ensembl ID:
ENSDARG00000036272
Human Orthologue:
GCGR
Human Description:
glucagon receptor [Source:HGNC Symbol;Acc:4192]
Mouse Orthologue:
Gcgr
Mouse Description:
glucagon receptor Gene [Source:MGI Symbol;Acc:MGI:99572]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31243 Nonsense Available for shipment Available now
sa19622 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31243
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021878 Nonsense 283 501 9 13
Genomic Location (Zv9):
Chromosome 1 (position 56899395)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55683328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGTTGTTGTGTGCAGATGCTGGGAGAGGAATATGAACATGGGCTACT[G/A]GTGGATCATCCGCTCTCCTATTCTCTTCGCTTATCTGGTAAGAGAATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19622
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021878 Essential Splice Site 388 501 13 13
Genomic Location (Zv9):
Chromosome 1 (position 56892097)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55676030
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAAATGCGTCATGTGAAAAGGGTCTATTGGTTCTGTCATGTGTGTGTA[G/A]GTGCAGAGCGAGATGCTGAAGAAGTGGAAGAGATGGAAACTAGGCAAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link