hoxa13b

Ensembl ID:
ENSDARG00000036254
ZFIN ID:
ZDB-GENE-980526-365
Description:
Homeobox protein Hox-A13b [Source:UniProtKB/Swiss-Prot;Acc:P79724]
Human Orthologue:
HOXA13
Human Description:
homeobox A13 [Source:HGNC Symbol;Acc:5102]
Mouse Orthologue:
Hoxa13
Mouse Description:
homeobox A13 Gene [Source:MGI Symbol;Acc:MGI:96173]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
hu3581 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu3581
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052662 Nonsense 181 289 1 2
Genomic Location (Zv9):
Chromosome 16 (position 22980925)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21090676
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGAACCGAGACATGAATCTCTACTGCCTGTGGAAACGTACCAGCCGTG[G/A]GCAATCACTAACGGGTGGAGCAGTCCAGTGTACTGCCCGAAAGATCAAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link