rras2

Ensembl ID:
ENSDARG00000036252
ZFIN ID:
ZDB-GENE-050417-352
Description:
ras-related protein R-Ras2 [Source:RefSeq peptide;Acc:NP_001017815]
Human Orthologue:
RRAS2
Human Description:
related RAS viral (r-ras) oncogene homolog 2 [Source:HGNC Symbol;Acc:17271]
Mouse Orthologue:
Rras2
Mouse Description:
related RAS viral (r-ras) oncogene homolog 2 Gene [Source:MGI Symbol;Acc:MGI:1914172]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34081 Nonsense Available for shipment Available now
sa34082 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34081
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052656 Nonsense 13 202 1 6
ENSDART00000123727 Nonsense 13 202 1 6
Genomic Location (Zv9):
Chromosome 7 (position 28960275)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 27563214
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGTGTCCCCGATGGCTGGCTGGAAGGACGGCTCAGTGCAGGAGAAATA[T/A]CGCCTGGTGGTCGTCGGAGGTGGTGGCGTCGGAAAATCAGCGTTAACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34082
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052656 Nonsense 141 202 5 6
ENSDART00000123727 Nonsense 141 202 5 6
Genomic Location (Zv9):
Chromosome 7 (position 29008669)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 27611608
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTTTAATGGAGGATGACTATTTTGTTCAGGTGACCCAAGAGGAAGGA[C/T]AGCAGCTCGCTCGACAACTCAAAGTCACATACATGGAGGCCTCAGCTAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link