tmem144b

Ensembl ID:
ENSDARG00000036247
ZFIN ID:
ZDB-GENE-041010-58
Description:
transmembrane protein 144b [Source:RefSeq peptide;Acc:NP_001005983]
Human Orthologue:
TMEM144
Human Description:
transmembrane protein 144 [Source:HGNC Symbol;Acc:25633]
Mouse Orthologue:
Tmem144
Mouse Description:
transmembrane protein 144 Gene [Source:MGI Symbol;Acc:MGI:1917902]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8641 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8641
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052648 Nonsense 244 380 8 12
Genomic Location:
Chromosome 14 (position 37106969)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGTATTTTCAGGTGTCCTTTATGGCAGTGCRTTTGTGCCTGTTTTTTA[T/A]ATGAAATTGCACGCCACAAATAATTCAAGCATGTTCATTGGATCCAGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sftl6f1d