jazf1a

Ensembl ID:
ENSDARG00000036243
ZFIN ID:
ZDB-GENE-060503-492
Description:
JAZF zinc finger 1 [Source:RefSeq peptide;Acc:NP_001038420]
Human Orthologue:
JAZF1
Human Description:
JAZF zinc finger 1 [Source:HGNC Symbol;Acc:28917]
Mouse Orthologue:
Jazf1
Mouse Description:
JAZF zinc finger 1 Gene [Source:MGI Symbol;Acc:MGI:2141450]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17317 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17317
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052646 Nonsense 140 292 3 5
ENSDART00000137340 Nonsense 79 231 3 5
Genomic Location:
Chromosome 19 (position 19006494)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGACTGAAGCAGCTCGCAGAGAGCAGGAAACGCAGAAGAAGAAGGTC[C/T]AACCCAAAATTGCTATATCAGTCACCGGCGGTGTATYGCGTAATAGTACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dy3nxo5r