gatm

Ensembl ID:
ENSDARG00000036239
ZFIN ID:
ZDB-GENE-021015-1
Description:
Glycine amidinotransferase, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q6PH19]
Human Orthologue:
GATM
Human Description:
glycine amidinotransferase (L-arginine:glycine amidinotransferase) [Source:HGNC Symbol;Acc:4175]
Mouse Orthologue:
Gatm
Mouse Description:
glycine amidinotransferase (L-arginine:glycine amidinotransferase) Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28947 Essential Splice Site Mutation detected in F1 DNA During 2017
sa28948 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28947
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052641 Essential Splice Site 95 422 2 9
Genomic Location (Zv9):
Chromosome 18 (position 265057)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40855
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGCCGAGCTGAAAACGCATGCGTGCCGCCGTTCACCGTGGAGGTGAAG[G/A]TGAGGATCTGCACACACACACACACACACACACACACACACACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28948
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052641 Nonsense 103 422 3 9
Genomic Location (Zv9):
Chromosome 18 (position 265253)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40659
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGTGTGTGTGTGTCTGCAGGCCAACACCTATGAGAAGTACTG[G/A]CCCTTCTACCAGCAGTACGGCGGTCAGACATTCCCGAAGGAGCACGTGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link