hibadha

Ensembl ID:
ENSDARG00000036236
ZFIN ID:
ZDB-GENE-040801-264
Description:
3-hydroxyisobutyrate dehydrogenase a [Source:RefSeq peptide;Acc:NP_001003646]
Human Orthologue:
HIBADH
Human Description:
3-hydroxyisobutyrate dehydrogenase [Source:HGNC Symbol;Acc:4907]
Mouse Orthologue:
Hibadh
Mouse Description:
3-hydroxyisobutyrate dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:1889802]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17219 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17219
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052639 Nonsense 106 328 3 8
Genomic Location:
Chromosome 19 (position 19068666)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCGCATCATCACCATGCTACCGTCCAGCCCCAACGTCATTGAGGTTTA[T/A]ACAGGRTCCAATGGCATCCTTAGGTGTGTTCACTCAAAATTAATTCTCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/iwn90577