si:ch211-232m8.2

Ensembl ID:
ENSDARG00000036215
ZFIN ID:
ZDB-GENE-081107-21
Description:
Novel protein similar to vertebrate lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte
Human Orthologue:
LCP2
Human Description:
lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa) [Source:HGNC Symbo
Mouse Orthologue:
Lcp2
Mouse Description:
lymphocyte cytosolic protein 2 Gene [Source:MGI Symbol;Acc:MGI:1321402]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22518 Essential Splice Site Available for shipment Available now
sa42420 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42421 Nonsense Mutation detected in F1 DNA During 2017
sa28340 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22518
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052605 Essential Splice Site 60 482 3 18
ENSDART00000131424 Essential Splice Site 60 405 3 15
Genomic Location (Zv9):
Chromosome 14 (position 35634493)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34163770
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAATATGACTGATAAGGATCTTAAAATGTTTCCCACGCCACATATTCC[G/A]TAAGTATTAATCTCAACAAGAACAAATATCTCAGAAAGATGGCAAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42420
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052605 Essential Splice Site 88 482 6 18
ENSDART00000131424   None 405 None 15
Genomic Location (Zv9):
Chromosome 14 (position 35637258)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34166535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATATGGTTTTGGACCCATTATATGCACAATCTAAAATGTTTATATTT[G/A]ATTTTCATTGTACAAAAGTAGAACCTACTTCAGGAGGTTGGGATTCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42421
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052605 Nonsense 388 482 16 18
ENSDART00000131424 Nonsense 311 405 13 15
Genomic Location (Zv9):
Chromosome 14 (position 35639188)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34168465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGGGGCAAATATCACGAGGAGAGGCCGAAGTCTCACTAAGAAAAGTG[A/T]AAAAGGTGAGTGGTATCACATTTTTGATTTACCTTAAATATATCCCTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28340
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052605 Splice Site, Nonsense 441 482 17 18
ENSDART00000131424 Splice Site, Nonsense 364 405 14 15
Genomic Location (Zv9):
Chromosome 14 (position 35639529)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34168806
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTGGAAACAAGGATGGATATTCCCTAGGAACAGGACTAAATGGCATC[G/T]AGGTAATGGCATCTGTTGATTTTGACAGAAATGTTTATCTTAAATATGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link