pitx2

Ensembl ID:
ENSDARG00000036194
ZFIN ID:
ZDB-GENE-990714-27
Description:
Pituitary homeobox 2 [Source:UniProtKB/Swiss-Prot;Acc:Q9W5Z2]
Human Orthologue:
PITX2
Human Description:
paired-like homeodomain 2 [Source:HGNC Symbol;Acc:9005]
Mouse Orthologue:
Pitx2
Mouse Description:
paired-like homeodomain transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:109340]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22522 Essential Splice Site Available for shipment Available now
sa250 Nonsense Confirmed mutation in F2 line During 2017

Mutation Details

Allele Name:
sa22522
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052569 Essential Splice Site 61 314 None 3
ENSDART00000148319 Essential Splice Site 16 269 None 4

The following transcripts of ENSDARG00000036194 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 37447856)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 35887183
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCTGCAATTAAATATTTGTTTAAAAAGAGTGTTTCCTTTTGCATTAC[A/G]GAGAAAGAAAAGGGACAAAGTAAAAACGAAGATTCGAACGATGACCCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa250
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052569 Nonsense 68 314 2 3
ENSDART00000148319 Nonsense 23 269 3 4

The following transcripts of ENSDARG00000036194 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 37447878)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 35887205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAAAAGAGTGTTTCCTTTTGCATTACAGAGAAAGAAAAGGGACAAAGT[A/T]AAAACGAAGATTCGAACGATGACCCGTCGAAAAAGAAGAGACAAAGGCGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link