myo1e

Ensembl ID:
ENSDARG00000036179
ZFIN ID:
ZDB-GENE-030131-5127
Human Orthologue:
MYO1E
Human Description:
myosin IE [Source:HGNC Symbol;Acc:7599]
Mouse Orthologue:
Myo1e
Mouse Description:
myosin IE Gene [Source:MGI Symbol;Acc:MGI:106621]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20980 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20979 Nonsense Mutation detected in F1 DNA During 2014
sa3642 Nonsense Mutation detected in F1 DNA During 2014
sa5423 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052539 Essential Splice Site 1 1117 1 29
Genomic Location:
Chromosome 7 (position 32059203)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGATTATAACAGAAGGTCGGCTGCAGTGTGATTAACCAATAAAAATGG[T/A]GAGTGAAAATACTTAACAGCACAGTCGCGTATCGCCTACGGAGAGAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20979
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052539 Nonsense 133 1117 5 29
Genomic Location:
Chromosome 7 (position 32013590)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGAAGACCGTAGCAGCAAAGTACATCATGGGCTACATCTCCAAAGTGT[C/A]AGGTGGAGGACCCAGAGTTCAGGTGGGTTGCACAGAGTACTTTAACAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3642
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052539 Nonsense 619 1117 18 29
Genomic Location:
Chromosome 7 (position 31989523)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTGAAGCACCAGGTGGAGTATTTGGGTCTGAAGGAGAATATAAGAGTA[C/T]GACGTGCAGGGTATGCTTACAGAAGAATCTTTCGCAAGTTCTTGAACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5423
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052539 Essential Splice Site 929 1117 24 29
Genomic Location:
Chromosome 7 (position 31975848)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATAAAATGCTGCAGGTCAGCATTGGACCCGGTTTGCCCAAAAACTCACG[T/C]AAGTGATGACTTGTTATTATAAATCACAAYATCATTAAACACTATTCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g2x2j6at