myo1e

Ensembl ID:
ENSDARG00000036179
ZFIN ID:
ZDB-GENE-030131-5127
Human Orthologue:
MYO1E
Human Description:
myosin IE [Source:HGNC Symbol;Acc:7599]
Mouse Orthologue:
Myo1e
Mouse Description:
myosin IE Gene [Source:MGI Symbol;Acc:MGI:106621]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20980 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20979 Nonsense Mutation detected in F1 DNA During 2016
sa26972 Nonsense Mutation detected in F1 DNA During 2016
sa30634 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40919 Nonsense Mutation detected in F1 DNA During 2016
sa40918 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052539 Essential Splice Site 1 1117 1 29
Genomic Location (Zv9):
Chromosome 7 (position 32059203)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30451545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGATTATAACAGAAGGTCGGCTGCAGTGTGATTAACCAATAAAAATGG[T/A]GAGTGAAAATACTTAACAGCACAGTCGCGTATCGCCTACGGAGAGAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20979
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052539 Nonsense 133 1117 5 29
Genomic Location (Zv9):
Chromosome 7 (position 32013590)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30405932
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGAAGACCGTAGCAGCAAAGTACATCATGGGCTACATCTCCAAAGTGT[C/A]AGGTGGAGGACCCAGAGTTCAGGTGGGTTGCACAGAGTACTTTAACAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26972
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052539 Nonsense 169 1117 6 29
Genomic Location (Zv9):
Chromosome 7 (position 32010404)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30402746
KASP Assay ID:
2259-8999.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCGAGGCCTTTGGGAATGCTAAGACAGTGAGGAACAACAACTCCAGT[C/T]GATTTGTAAGCATTAGTCATCCTCCCGTTATTTTATATTTATTATTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30634
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052539 Essential Splice Site 260 1117 9 29
Genomic Location (Zv9):
Chromosome 7 (position 32007057)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30399399
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTGTAACTTCCCTCTTTTTCTTCTGTGTGTCTCTCTGTCTGACCCCA[G/A]CATGCCATGGACGTGATTGGTATCTCAGGGATTGACCGCACCATGGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40919
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052539 Nonsense 715 1117 20 29
Genomic Location (Zv9):
Chromosome 7 (position 31982646)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30374988
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAGAACCATTCAGACTGCCTGGAGGAAATATTGTGCACGCAAGAAATA[T/G]GTTCAGATGAGAGAGGAAGGTAGGTTTAGACTTTAGATTTAGATAGATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052539 Nonsense 1069 1117 28 29
Genomic Location (Zv9):
Chromosome 7 (position 31972446)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30364788
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCTGCCCCCAAACCAAAGCCTCAGGTGCCTCAGTGTAAAGCTCTTTA[T/A]GCCTACGACGCTCAGGACACCGATGAGCTCAGTTTCAACGCAGATGACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link