pcdh1

Ensembl ID:
ENSDARG00000036175
Human Orthologue:
PCDH1
Human Description:
protocadherin 1 [Source:HGNC Symbol;Acc:8655]
Mouse Orthologue:
Pcdh1
Mouse Description:
protocadherin 1 Gene [Source:MGI Symbol;Acc:MGI:104692]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17938 Nonsense Available for shipment Available now
sa35735 Nonsense Mutation detected in F1 DNA During 2017
sa10175 Nonsense Available for shipment Available now
sa42430 Nonsense Mutation detected in F1 DNA During 2017
sa35736 Nonsense Mutation detected in F1 DNA During 2017
sa28349 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa17938
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105588 Nonsense 9 1093 1 4
Genomic Location (Zv9):
Chromosome 14 (position 38827707)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 37212860
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTTTTGCAGCAACAGACTGACGATGTGYCAGAGTGCCAATGCGATGTG[G/A]TCACGGTGGAGTGCCATGCTAGWGTGGATTTTGCTTCTCCTCTGCTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35735
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105588 Nonsense 208 1093 1 4
Genomic Location (Zv9):
Chromosome 14 (position 38828303)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 37213456
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGCAGGTGGCACAAGACTCTGACGAGAAATTACCGCAACTCATTGTAT[T/A]GGGTAACCTGGATAGAGAACTGCGAGATTCATACGACCTCAATATAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10175
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105588 Nonsense 290 1093 2 4
ENSDART00000105588 Nonsense 290 1093 2 4
Genomic Location (Zv9):
Chromosome 14 (position 38830121)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 37215274
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGGTGAAGRCCAATGACTCTGACATGGGACCCAATGGTGAGGTTACCTA[C/A]AGCCTCCATCAGCCATCATCACCAGTGATGAGACTTCTAAGCATTGACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42430
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105588 Nonsense 363 1093 2 4
Genomic Location (Zv9):
Chromosome 14 (position 38830338)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 37215491
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTATCACAGTGAAAGATCAGAATGACAACGCACCCTCCATTAGAATC[C/T]GAGGCATTGGCCTTGTAACGCATGAAGATGGTGTCGCTAACATATCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35736
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105588 Nonsense 551 1093 2 4
Genomic Location (Zv9):
Chromosome 14 (position 38830904)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 37216057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGAAGTGCGTGTCATGAGCCAGTTGGACCGTGAACAATTAGATCACTA[T/A]CAATTTCTGGTCGCAGCAGCTGATAAAGGTGTACCAAGCCTAAGAGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28349
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105588 Essential Splice Site 1003 1093 3 4
Genomic Location (Zv9):
Chromosome 14 (position 38987028)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 37372181
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCATCGGCTTGTCCACTGACCTTTGACTTCTCTCTCTCTCTCCAATCAC[A/C]GCTCCCACATCGCCGAGTGACCTTCTCCACAGCCAATCAGGCGCAGGATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)
  • Myopia (pathological): A genome-wide meta-analysis identifies two novel loci associated with high myopia in the Han Chinese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link