rnasel3

Ensembl ID:
ENSDARG00000036171
ZFIN ID:
ZDB-GENE-050809-5
Description:
Ribonuclease-like 3N-terminal peptideLF-ZF3 [Source:UniProtKB/Swiss-Prot;Acc:A5HAK0]
Human Orthologues:
AL355922.1, ANG, RNASE1, RNASE2, RNASE3, RNASE4, RNASE6, RNASE7, RNASE8
Human Descriptions:
angiogenin, ribonuclease, RNase A family, 5 [Source:HGNC Symbol;Acc:483]
ribonuclease, RNase A family, 1 (pancreatic) [Source:HGNC Symbol;Acc:10044]
ribonuclease, RNase A family, 2 (liver, eosinophil-derived neurotoxin) pseudogene (ECRP), non-coding
ribonuclease, RNase A family, 2 (liver, eosinophil-derived neurotoxin) [Source:HGNC Symbol;Acc:10045
ribonuclease, RNase A family, 3 [Source:HGNC Symbol;Acc:10046]
ribonuclease, RNase A family, 4 [Source:HGNC Symbol;Acc:10047]
ribonuclease, RNase A family, 7 [Source:HGNC Symbol;Acc:19278]
ribonuclease, RNase A family, 8 [Source:HGNC Symbol;Acc:19277]
ribonuclease, RNase A family, k6 [Source:HGNC Symbol;Acc:10048]
Mouse Orthologues:
Ang, Ang2, Ang4, Ang5, Ang6, Ear1, Ear10, Ear11, Ear14, Ear2, Ear5, Ear6, Rnase1, Rnase4, Rnase6
Mouse Descriptions:
angiogenin, ribonuclease A family, member 2 Gene [Source:MGI Symbol;Acc:MGI:104984]
angiogenin, ribonuclease A family, member 4 Gene [Source:MGI Symbol;Acc:MGI:2656551]
angiogenin, ribonuclease A family, member 5 Gene [Source:MGI Symbol;Acc:MGI:3528599]
angiogenin, ribonuclease A family, member 6 Gene [Source:MGI Symbol;Acc:MGI:3528602]
angiogenin, ribonuclease, RNase A family, 5 Gene [Source:MGI Symbol;Acc:MGI:88022]
eosinophil-associated, ribonuclease A family, member 1 Gene [Source:MGI Symbol;Acc:MGI:108021]
eosinophil-associated, ribonuclease A family, member 10 Gene [Source:MGI Symbol;Acc:MGI:1890464]
eosinophil-associated, ribonuclease A family, member 11 Gene [Source:MGI Symbol;Acc:MGI:1890465]
eosinophil-associated, ribonuclease A family, member 14 Gene [Source:MGI Symbol;Acc:MGI:3528616]
eosinophil-associated, ribonuclease A family, member 2 Gene [Source:MGI Symbol;Acc:MGI:108020]
eosinophil-associated, ribonuclease A family, member 5 Gene [Source:MGI Symbol;Acc:MGI:1858598]
eosinophil-associated, ribonuclease A family, member 6 Gene [Source:MGI Symbol;Acc:MGI:1890463]
ribonuclease, RNase A family 4 Gene [Source:MGI Symbol;Acc:MGI:1926217]
ribonuclease, RNase A family, 1 (pancreatic) Gene [Source:MGI Symbol;Acc:MGI:97919]
ribonuclease, RNase A family, 6 Gene [Source:MGI Symbol;Acc:MGI:1925666]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2767 Nonsense F2 line generated During 2014
sa1435 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2767
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041329 Nonsense 55 149 1 1
Genomic Location:
Chromosome 14 (position 40044971)
KASP Assay ID:
554-3363.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTCTATGGAGGCATAACTGAGCAGACATGTGACAGAGTCATGCGTCAG[A/T]GAGGCATCACACGATTTCCAACTGGCAATGACTGCAAAGAAGTCAACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1435
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041329 Nonsense 90 149 1 1
Genomic Location:
Chromosome 14 (position 40045076)
KASP Assay ID:
554-1362.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAAGCAAATGGTAACCATGTTAGAACAGTTTGTACTGGGGGTGGAACT[C/T]GACAAACTGATAACAGAGACTTGTACATGAGCAACAATCAGTTCACTGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oonezaue