nfatc1

Ensembl ID:
ENSDARG00000036168
ZFIN ID:
ZDB-GENE-060503-677
Description:
nuclear factor of activated T-cells, cytoplasmic 1 [Source:RefSeq peptide;Acc:NP_001038624]
Human Orthologue:
NFATC1
Human Description:
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 [Source:HGNC Symbol;Acc:77
Mouse Orthologue:
Nfatc1
Mouse Description:
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 Gene [Source:MGI Symbol;Ac

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36826 Nonsense Mutation detected in F1 DNA During 2017
sa39244 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36826
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052521 Nonsense 283 867 2 10
ENSDART00000134749 Nonsense 277 633 1 7
Genomic Location (Zv9):
Chromosome 19 (position 22706077)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22637457
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGCCCTCACCACAGATGGATTAACAGATCTTGCAGAGGGGATTCCTT[T/A]GAAGTCCCGCAAGACCAGTCTGGAACACAGTGCTTCAATGAACCTGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39244
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052521 Nonsense 534 867 6 10
ENSDART00000134749 Nonsense 528 633 5 7
Genomic Location (Zv9):
Chromosome 19 (position 22722107)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22653487
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTTCCTCACTTTCCTTCTGTGTCCTTCTTGCAGCCCAGCGCTCAGCA[C/T]AGGAGTTGCCCCTCGTGGATAAACAGAGCATGGAAAGCTGTGCCGCCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link