cars

Ensembl ID:
ENSDARG00000036164
ZFIN ID:
ZDB-GENE-030328-29
Description:
cysteinyl-tRNA synthetase, cytoplasmic [Source:RefSeq peptide;Acc:NP_001112372]
Human Orthologue:
CARS
Human Description:
cysteinyl-tRNA synthetase [Source:HGNC Symbol;Acc:1493]
Mouse Orthologue:
Cars
Mouse Description:
cysteinyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:1351477]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40931 Nonsense Mutation detected in F1 DNA During 2016
sa40930 Nonsense Mutation detected in F1 DNA During 2016
sa964 Nonsense Available for shipment Available now
sa8498 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40931
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052514 Nonsense 340 824 10 23
ENSDART00000126516 Nonsense 348 832 11 25
ENSDART00000129720 Nonsense 261 745 9 22
ENSDART00000130429 Nonsense 261 652 9 19
Genomic Location (Zv9):
Chromosome 7 (position 33150220)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31544560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGAATATAAAAGAATGAATTTCTGCTCTTTTTTTTTTTTGTAAGGTA[T/A]GAGTCCAATGGATCTGTATATTTTGACACGGCAAAGTTTGATTCTTGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40930
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052514 Nonsense 426 824 12 23
ENSDART00000126516 Nonsense 434 832 13 25
ENSDART00000129720 Nonsense 347 745 11 22
ENSDART00000130429 Nonsense 347 652 11 19
Genomic Location (Zv9):
Chromosome 7 (position 33147153)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31541493
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTATTCTGCTGGTGTTGTTACAGGGGAGACCTGGTTGGCATATTGAGTG[T/A]TCTGCCATGGCCGGATCCATACTAGGAGAATCTATGGATATCCACGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa964
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052514 Nonsense 487 824 13 23
ENSDART00000126516 Nonsense 495 832 14 25
ENSDART00000129720 Nonsense 408 745 12 22
ENSDART00000130429 Nonsense 408 652 12 19
Genomic Location (Zv9):
Chromosome 7 (position 33145543)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31539883
KASP Assay ID:
554-0869.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATATTTCTTGCACACGGGTCACCTCACCATCGCCGGATGCAAAATGTCC[A/T]AATCTCTGAAGAACTTTATCACCATCAAAGATGCCCWGGCCAAACATACA
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control on top; Mutant below; 5 dpf

Control on top; Mutant below; 5 dpf

zoom

Control; 5 dpf

Control; 5 dpf

zoom

Mutant; 5 dpf

Mutant; 5 dpf

zoom

Control; 5 dpf

Control; 5 dpf

zoom

Mutant; 5 dpf

Mutant; 5 dpf

zoom

Stage Entity Entity Quality Tag
Larval:Day 5
ZFS:0000037
eye
ZFA:0000107

decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
gut
ZFA:0000112

quality
PATO:0000001
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
head
ZFA:0001114

decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
inner ear
ZFA:0000217

decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
larval locomotory behavior
GO:0008345

absent
PATO:0000462
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
lateral larval melanophore stripe
ZFA:0005223
melanocyte
ZFA:0009091
present in fewer numbers in organism
PATO:0001997
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
pericardium
ZFA:0000054

edematous
PATO:0001450
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
skeletal muscle
ZFA:0005277

degenerate
PATO:0000639
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
swim bladder
ZFA:0000076

aplastic
PATO:0001483
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094

decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
yolk
ZFA:0000084

increased size
PATO:0000586
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa8498
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052514 Essential Splice Site 571 824 15 23
ENSDART00000126516 Essential Splice Site 579 832 16 25
ENSDART00000129720 Essential Splice Site 492 745 14 22
ENSDART00000130429 Essential Splice Site 492 652 14 19
Genomic Location (Zv9):
Chromosome 7 (position 33141499)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31535839
KASP Assay ID:
2259-9038.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGCCAATATGAGAAATGGGAAGCTGAGGAGATTGAACTGAACAAATGG[T/G]AACTTGTATGATTCTTACATGATTGTCATTTTTCAAAAGTTAAATTTCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link