hnrnpa0l

Ensembl ID:
ENSDARG00000036161
ZFIN ID:
ZDB-GENE-030131-618
Description:
Hnrpa0l protein [Source:UniProtKB/TrEMBL;Acc:Q7ZU48]
Human Orthologue:
HNRNPA0
Human Description:
heterogeneous nuclear ribonucleoprotein A0 [Source:HGNC Symbol;Acc:5030]
Mouse Orthologue:
Hnrnpa0
Mouse Description:
heterogeneous nuclear ribonucleoprotein A0 Gene [Source:MGI Symbol;Acc:MGI:1924384]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18044 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18044
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052511 Nonsense 124 302 1 1
Genomic Location:
Chromosome 14 (position 40346381)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCGAGGACGAACACCTTCAAGATTATTTCTCACAGTTTGGGCCCATC[G/T]ARAAGGCGCAGGTCATMACCGACAAAGACACCGGGAAGAAGCGAGGCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b7pr4l96