trhr

Ensembl ID:
ENSDARG00000036159
ZFIN ID:
ZDB-GENE-060503-382
Description:
thyrotropin-releasing hormone receptor 1 [Source:RefSeq peptide;Acc:NP_001108160]
Human Orthologue:
TRHR
Human Description:
thyrotropin-releasing hormone receptor [Source:HGNC Symbol;Acc:12299]
Mouse Orthologue:
Trhr
Mouse Description:
thyrotropin releasing hormone receptor Gene [Source:MGI Symbol;Acc:MGI:98824]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12805 Nonsense Available for shipment Available now
sa23513 Splice Site, Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12805
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052509 Nonsense 60 399 1 2
Genomic Location:
Chromosome 19 (position 23214606)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTTGGTGGTCCTCACCACGAAACATATGCGGACCCCGACCAMTGGCTA[T/A]CTRGTTAGTTTGGCTGTCGCAGACCTRATGGTGTTGRTCGCAGCCGGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23513
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052509 Splice Site, Nonsense 258 399 1 2
Genomic Location:
Chromosome 19 (position 23215198)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGAAGAGTTCCAGCCGCTGCTCCAGTACAACTGCAGCATCCAGAAGA[C/T]AGGTGAGAGGATTATTTTGCGTTTCATCAATCTAAGATCATGGTTTGCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass (lean): Genome-wide association and replication studies identified TRHR as an important gene for lean body mass. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kit6q068