nudcd1

Ensembl ID:
ENSDARG00000036158
ZFIN ID:
ZDB-GENE-050522-483
Description:
NudC domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q503C8]
Human Orthologue:
NUDCD1
Human Description:
NudC domain containing 1 [Source:HGNC Symbol;Acc:24306]
Mouse Orthologue:
Nudcd1
Mouse Description:
NudC domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1914679]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43276 Essential Splice Site Mutation detected in F1 DNA During 2017
sa23515 Nonsense Available for shipment Available now
sa43275 Nonsense Mutation detected in F1 DNA During 2017
sa23514 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43276
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052503 Essential Splice Site 347 585 6 10
Genomic Location (Zv9):
Chromosome 19 (position 23293452)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23222867
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTGTTGACCCCGAGGCCAGCACTTGGACCATGAATGATGATAAGAGG[T/G]AAAAGAAATACAAGTAAAGCTTATTACTGCACTTTTCATGTTGGAACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23515
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052503 Nonsense 348 585 7 10
Genomic Location (Zv9):
Chromosome 19 (position 23275196)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23204611
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACAAAAGTTTATCTGGATTTTTGTTGTTGTTGTTGTTGTGTGTAGTT[T/A]GGAAGTCAGTCTACAGAAGCGAAGTGAAGGCCCACTATGGTCCGAAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43275
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052503 Nonsense 379 585 7 10
Genomic Location (Zv9):
Chromosome 19 (position 23275104)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23204519
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGAAGTGGTTTTGGGGGACCGGAGAGGAGAGTATCTGATGAATGATGAA[C/T]AGAAATCACAGCTCCAGCAGAGGCTCTCGTATCTCACTTCTGAGGACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23514
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052503 Nonsense 524 585 10 10
Genomic Location (Zv9):
Chromosome 19 (position 23245809)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23175224
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTTCTCCTACGCTGCCCTTTGTGAGTGCCTCAGACGCATCTTCATTTA[T/A]CGCCAGCCCTCGCCGGTCGACACGGTGCTCTTCAACCGGAAACAGGGTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link