si:ch211-248e11.3

Ensembl ID:
ENSDARG00000036156
ZFIN ID:
ZDB-GENE-081105-105
Description:
formin-binding protein 1 [Source:RefSeq peptide;Acc:NP_001116716]
Human Orthologue:
FNBP1
Human Description:
formin binding protein 1 [Source:HGNC Symbol;Acc:17069]
Mouse Orthologue:
Fnbp1
Mouse Description:
formin binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:109606]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21213 Nonsense Available for shipment Available now
sa34330 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21213
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091752 Nonsense 471 627 12 15
Genomic Location (Zv9):
Chromosome 8 (position 12101832)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11546595
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTATAGATCCACGGTTAGAAGAAATCACTCAAAGCTTGGAGAAGTTG[C/T]AGTTTGAGGCACATAAATACGAGGTGTGACATTCACAAATTCGGAGACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34330
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091752 Nonsense 579 627 15 15
Genomic Location (Zv9):
Chromosome 8 (position 12095999)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11540762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCATGTTTTTGTGTGTGTAGGTCAGAATGAAGGCACTATATCCATGGCC[G/T]AGGGCGAGATGCTGTATGTAATCGAGGAGGATAAAGGGGACGGATGGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link