ano5b

Ensembl ID:
ENSDARG00000036147
ZFIN ID:
ZDB-GENE-061215-108
Description:
anoctamin 5b [Source:RefSeq peptide;Acc:NP_001073452]
Human Orthologue:
ANO5
Human Description:
anoctamin 5 [Source:HGNC Symbol;Acc:27337]
Mouse Orthologue:
Ano5
Mouse Description:
anoctamin 5 Gene [Source:MGI Symbol;Acc:MGI:3576659]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5425 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5425
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099919 Nonsense 572 890 13 18
ENSDART00000132504 None None 167 None 4
ENSDART00000141828 Nonsense 597 915 14 19

The following transcripts of ENSDARG00000036147 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 34183184)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTAAAGATTTGGATGTTTTTCATGTTTAGTGTGCTCCTGGAGGTTG[T/A]CTGATTGAGCTGACCACTCAGCTRCTTATTGTCATGGCTGGGAAACAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vpj6o70j