lctla

Ensembl ID:
ENSDARG00000036139
ZFIN ID:
ZDB-GENE-040718-233
Description:
lactase-like [Source:RefSeq peptide;Acc:NP_001002735]
Human Orthologue:
LCTL
Human Description:
lactase-like [Source:HGNC Symbol;Acc:15583]
Mouse Orthologue:
Lctl
Mouse Description:
lactase-like Gene [Source:MGI Symbol;Acc:MGI:2183549]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20996 Essential Splice Site Mutation detected in F1 DNA During 2014
sa543 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa20996
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052477 Essential Splice Site 97 552 4 15
Genomic Location:
Chromosome 7 (position 35572649)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGTATGTAGATGTTCTGGTTTTTAAGGCAGTTTTTTTGTTGTTGTTTT[A/G]GGATGATATCTCACTGATGAAAGACATGAAGCTGAACCACTACCTCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa543
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052477 Nonsense 535 552 14 15
Genomic Location:
Chromosome 7 (position 35578595)
KASP Assay ID:
554-0453.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCWATTATAACTTTCTCATTTTCTTTTGTTTGCCCTTTCAGCTAGAAGA[A/T]AGTCCAAGGAACATGCAGATATGCCAAAGGTTTGGCCTGTGCATGATGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/914gi7i4