
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
lctla
- Ensembl ID:
- ENSDARG00000036139
- ZFIN ID:
- ZDB-GENE-040718-233
- Description:
- lactase-like [Source:RefSeq peptide;Acc:NP_001002735]
- Human Orthologue:
- LCTL
- Human Description:
- lactase-like [Source:HGNC Symbol;Acc:15583]
- Mouse Orthologue:
- Lctl
- Mouse Description:
- lactase-like Gene [Source:MGI Symbol;Acc:MGI:2183549]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa20996 | Essential Splice Site | Available for shipment | Available now |
sa543 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa20996
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052477 | Essential Splice Site | 97 | 552 | 4 | 15 |
- Genomic Location (Zv9):
- Chromosome 7 (position 35572649)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 33958267 GRCz11 7 34229417 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATGTATGTAGATGTTCTGGTTTTTAAGGCAGTTTTTTTGTTGTTGTTTT[A/G]GGATGATATCTCACTGATGAAAGACATGAAGCTGAACCACTACCTCTTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa543
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052477 | Nonsense | 535 | 552 | 14 | 15 |
- Genomic Location (Zv9):
- Chromosome 7 (position 35578595)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 33964210 GRCz11 7 34235360 - KASP Assay ID:
- 554-0453.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATCWATTATAACTTTCTCATTTTCTTTTGTTTGCCCTTTCAGCTAGAAGA[A/T]AGTCCAAGGAACATGCAGATATGCCAAAGGTTTGGCCTGTGCATGATGAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: