tipin

Ensembl ID:
ENSDARG00000036136
ZFIN ID:
ZDB-GENE-040801-189
Description:
TIMELESS-interacting protein [Source:UniProtKB/Swiss-Prot;Acc:Q6DBR4]
Human Orthologue:
TIPIN
Human Description:
TIMELESS interacting protein [Source:HGNC Symbol;Acc:30750]
Mouse Orthologue:
Tipin
Mouse Description:
timeless interacting protein Gene [Source:MGI Symbol;Acc:MGI:1921571]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1733 Splice Site, Nonsense Available for shipment Available now
sa14308 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1733
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052474 Splice Site, Nonsense 144 296 5 8
Genomic Location:
Chromosome 7 (position 35582407)
KASP Assay ID:
554-1678.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAAGAGTTCATCGATAAAGTAGAGAATCTGGGAGGCAAAAAAGAAGTT[C/T]AGGTGAGATTTCTGCTTTTATATCTCTTGATGAAAAAKAAATCAATCTTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa14308
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052474 Nonsense 249 296 8 8
Genomic Location:
Chromosome 7 (position 35583530)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATGCAGATGAACCATCAACCAGCTCTTCAGGACAGTTCCTCAGTGAW[G/T]AGAAMCCCAAAACCACCTCAAACCAAACTCCACTCAAACAWAAGCCAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ih17ho1s