pcdh10b

Ensembl ID:
ENSDARG00000036121
ZFIN ID:
ZDB-GENE-030721-4
Description:
protocadherin 10b [Source:RefSeq peptide;Acc:NP_878305]
Human Orthologue:
PCDH10
Human Description:
protocadherin 10 [Source:HGNC Symbol;Acc:13404]
Mouse Orthologue:
Pcdh10
Mouse Description:
protocadherin 10 Gene [Source:MGI Symbol;Acc:MGI:1338042]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22534 Nonsense Available for shipment Available now
sa1760 Nonsense Available for shipment Available now
sa42436 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42437 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22534
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052444 Nonsense 85 1026 1 5
Genomic Location (Zv9):
Chromosome 14 (position 45365183)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 42632929
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGAGTGCTTTTCGTGAACGAGAAAATCGACCGGGAGCGCATCTGCAAG[C/T]AGAGCGCCAGCTGTTTGCTTCACCTGGAGGTGTTCCTGGAGAACCCGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1760
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052444 Nonsense 630 1026 1 5
Genomic Location (Zv9):
Chromosome 14 (position 45363546)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 42631292
KASP Assay ID:
554-1753.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCGCACAGCCCGCCGGGTGTCAGTCAAACGTGACCCGCAGCAGCTGTA[C/A]GAGCTGCTGATTGAAGTGAGGGATCACGGGCAGCCTCCAATGTCGTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42436
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052444 Essential Splice Site 1020 1026 4 5
ENSDART00000052444 Essential Splice Site 1020 1026 4 5
Genomic Location (Zv9):
Chromosome 14 (position 45223697)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 42618331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATGCACTTCTGTGTAACTCTCGCATGCCTTACAAAGCCGCCTGTCTGT[G/A]TGAGTATCTCGAAGAGAGAGCGCTATCCTCTCTCTTGATCTGACCCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42437
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052444 Essential Splice Site 1020 1026 4 5
ENSDART00000052444 Essential Splice Site 1020 1026 4 5
Genomic Location (Zv9):
Chromosome 14 (position 45223697)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 42618331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATGCACTTCTGTGTAACTCTCGCATGCCTTACAAAGCCGCCTGTCTGT[G/A]TGAGTATCTCGAAGAGAGAGCGCTATCCTCTCTCTTGATCTGACCCCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link