NP_571531.1

Ensembl ID:
ENSDARG00000036118
Description:
catenin alpha-1 [Source:RefSeq peptide;Acc:NP_571531]
Human Orthologue:
CTNNA1
Human Description:
catenin (cadherin-associated protein), alpha 1, 102kDa [Source:HGNC Symbol;Acc:2509]
Mouse Orthologue:
Ctnna1
Mouse Description:
catenin (cadherin associated protein), alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88274]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24534 Essential Splice Site Available for shipment Available now
sa39460 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24534
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052441 Essential Splice Site 766 907 16 18
Genomic Location (Zv9):
Chromosome 24 (position 35883603)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 34652912
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAAGCCGGATCAAGAATGGACAAGCTGGGCCGCGCCATTGCAGATCAA[G/T]TAAGTTCAACTCGAGTCCGTTTCGCAGAAAACACACACGCATCATCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39460
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052441 Essential Splice Site 766 907 16 18
Genomic Location (Zv9):
Chromosome 24 (position 35883602)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 34652911
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGCCGGATCAAGAATGGACAAGCTGGGCCGCGCCATTGCAGATCAAG[T/C]AAGTTCAACTCGAGTCCGTTTCGCAGAAAACACACACGCATCATCTTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link