si:ch211-153f2.6

Ensembl ID:
ENSDARG00000036114
ZFIN ID:
ZDB-GENE-081031-18
Description:
Novel protein similar to vertebrate phosphatidylserine synthase 1 (PTDSS1) [Source:UniProtKB/TrEMBL;
Human Orthologue:
PTDSS1
Human Description:
phosphatidylserine synthase 1 [Source:HGNC Symbol;Acc:9587]
Mouse Orthologue:
Ptdss1
Mouse Description:
phosphatidylserine synthase 1 Gene [Source:MGI Symbol;Acc:MGI:1276575]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36921 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36921
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052430 Essential Splice Site 299 464 8 13
ENSDART00000146981 Essential Splice Site 243 358 7 10
Genomic Location (Zv9):
Chromosome 19 (position 47848979)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 46486303
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATCTTTAGGTTTTGCTGATCTTTGTCCTCTTCTTTTCTCCTCCAACA[G/A]CTCACAGAGTTGAACACCTTTTTCCTGAAGCACATCTTCGTGTTTCAGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link