mtx1b

Ensembl ID:
ENSDARG00000036109
ZFIN ID:
ZDB-GENE-021210-1
Description:
metaxin 1 [Source:RefSeq peptide;Acc:NP_001007281]
Human Orthologue:
MTX1
Human Description:
metaxin 1 [Source:HGNC Symbol;Acc:7504]
Mouse Orthologue:
Mtx1
Mouse Description:
metaxin 1 Gene [Source:MGI Symbol;Acc:MGI:103025]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36839 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36839
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052422 Essential Splice Site 27 317 1 8
Genomic Location (Zv9):
Chromosome 19 (position 24970327)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 24900439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGCGACTATGGATTACCTTCAGTAGACGTCGACTGTTTAGCCGTACTG[G/T]TAAGGGAAAATCTGGTCGGATGTTATAGTAGTTTTCGCTGTTTTATGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link