pard6gb

Ensembl ID:
ENSDARG00000036090
ZFIN ID:
ZDB-GENE-010319-35
Description:
partitioning defective 6 homolog gamma [Source:RefSeq peptide;Acc:NP_997728]
Human Orthologue:
PARD6G
Human Description:
par-6 partitioning defective 6 homolog gamma (C. elegans) [Source:HGNC Symbol;Acc:16076]
Mouse Orthologue:
Pard6g
Mouse Description:
par-6 partitioning defective 6 homolog gamma (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2135606]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23530 Nonsense Available for shipment Available now
sa43287 Nonsense Mutation detected in F1 DNA During 2017
sa6558 Nonsense Mutation detected in F1 DNA During 2017
sa23529 Nonsense Available for shipment Available now
sa36844 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23530
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052393 Nonsense 14 434 1 3
Genomic Location (Zv9):
Chromosome 19 (position 26258452)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 26188564
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGAGCAAAATGAACCGGAGTTTTAATAAATCACAATCTTTGCGTAGCT[T/A]GAACATGAACGCGGTGGAAGTGAAAAGCAAGGTGAGTTGAATGTGCAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43287
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052393 Nonsense 127 434 3 3
Genomic Location (Zv9):
Chromosome 19 (position 26187675)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 26117787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGACCCGTAAAAAAAAGGCAGTGGTCACTCTTCGCAATGACCTGAAC[A/T]GAAAACGGCCCCACATTCGCATTGGCATGCCTCAAGACTTTCGTCCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052393 Nonsense 157 434 3 3
Genomic Location (Zv9):
Chromosome 19 (position 26187585)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 26117697
KASP Assay ID:
554-5196.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCGTCCTGTGTCRTCCATTATTGACGTGGACATCCTTCCTGAATCTCAT[C/T]GAAGAGTWCGWCTCTACCGGTATGGCTCGGACAAGCCCCTGGGATTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23529
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052393 Nonsense 346 434 3 3
Genomic Location (Zv9):
Chromosome 19 (position 26187018)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 26117130
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGGTCCCAGACACAAACGACCACTGTGACCCCACCTAGCCCTCCTACT[C/T]GACCTCAAACGAGACCGCCATCCACTGTGTCTACAGCCTCTTTTCATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36844
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052393 Nonsense 376 434 3 3
Genomic Location (Zv9):
Chromosome 19 (position 26186926)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 26117038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCATTCTCAACCAAGCTTTAATGGCACCGTACACAATAGTTTGAGTTA[C/A]AAGTTGCATAAGGACCTAACCCTTCAACACCACCCCTACCACAGCAGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link