itga11a

Ensembl ID:
ENSDARG00000036086
ZFIN ID:
ZDB-GENE-050324-1
Description:
integrin, alpha 11a [Source:RefSeq peptide;Acc:NP_001166098]
Human Orthologue:
ITGA11
Human Description:
integrin, alpha 11 [Source:HGNC Symbol;Acc:6136]
Mouse Orthologue:
Itga11
Mouse Description:
integrin alpha 11 Gene [Source:MGI Symbol;Acc:MGI:2442114]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13635 Nonsense Available for shipment Available now
sa9327 Essential Splice Site Mutation detected in F1 DNA During 2016
sa18873 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13635
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052389 Nonsense 454 1228 11 30
ENSDART00000127081 Nonsense 416 1190 11 30
Genomic Location (Zv9):
Chromosome 7 (position 34542221)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32936561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAGGAGACTCGGCAAGGGAAAGTGGKTCCACCGAAWTCCTCCTATGAA[C/T]AAGAGTTCCCAGAAGAACTAAAGAACCATGGAGCCTACCTGGGTAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9327
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052389 Essential Splice Site 972 1228 23 30
ENSDART00000127081 Essential Splice Site 934 1190 23 30
ENSDART00000052389 Essential Splice Site 972 1228 23 30
ENSDART00000127081 Essential Splice Site 934 1190 23 30
Genomic Location (Zv9):
Chromosome 7 (position 34523342)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32917682
KASP Assay ID:
554-6136.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGAGTGYAAAAGCCTGTGAGGTTTCTCATRTTGTTGTCRTGTGTCTGC[A/C]GTGAAGGAGAAGAAGTCATCCTCTATGAYAACTCCAATGAAATTTTCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18873
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052389 Essential Splice Site 972 1228 23 30
ENSDART00000127081 Essential Splice Site 934 1190 23 30
ENSDART00000052389 Essential Splice Site 972 1228 23 30
ENSDART00000127081 Essential Splice Site 934 1190 23 30
Genomic Location (Zv9):
Chromosome 7 (position 34523342)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32917682
KASP Assay ID:
554-6136.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGAGTGTAAAAGCCTGTGAGGTTTCTCATATTGTTGTCATGTGTCTGC[A/C]GTGAAGGAGAAGAAGTCATCCTCTATGATAACTCCAATGAAATTTTCTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link