cd81

Ensembl ID:
ENSDARG00000036080
ZFIN ID:
ZDB-GENE-000831-5
Description:
CD81 antigen [Source:RefSeq peptide;Acc:NP_571593]
Human Orthologue:
CD81
Human Description:
CD81 molecule [Source:HGNC Symbol;Acc:1701]
Mouse Orthologue:
Cd81
Mouse Description:
CD81 antigen Gene [Source:MGI Symbol;Acc:MGI:1096398]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10614 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052383 Nonsense 31 236 2 8
Genomic Location:
Chromosome 7 (position 34348580)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTTCTCTTCCTCTTTGTGTTGTTTTTAGCTGGCTGGTTGTGTAATCT[T/A]GGGGGTTTCTCTCTGGCTCCGTCATGACRCTAAAACGAGCAGTCTTCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a9wfbty3