heatr3

Ensembl ID:
ENSDARG00000036076
ZFIN ID:
ZDB-GENE-040426-1876
Description:
HEAT repeat-containing protein 3 [Source:RefSeq peptide;Acc:NP_957183]
Human Orthologue:
HEATR3
Human Description:
HEAT repeat containing 3 [Source:HGNC Symbol;Acc:26087]
Mouse Orthologue:
Heatr3
Mouse Description:
HEAT repeat containing 3 Gene [Source:MGI Symbol;Acc:MGI:2444491]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1194 Nonsense Available for shipment Available now
sa14921 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1194
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052368 Nonsense 187 682 5 15

The following transcripts of ENSDARG00000036076 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 39304725)
KASP Assay ID:
554-1103.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACAGCAGTGTCCGTGTTTAACAAGGCTGGACTTGTGGATGTTCTTCTA[C/T]AATGTCTACAAAAGCACCCTCAGAATATGGAGCTGGCAATATCAGCAGGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa14921
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052368 Nonsense 356 682 8 15

The following transcripts of ENSDARG00000036076 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 39297838)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCTCARCAAATACTTTTNGTTTGTGTGCCTGTGGGTTTCTAGCGAGAC[C/T]RACTGGAGTTGCGAGAGGCYAAAGCACTGCTGTCAGCACAGCAAACGTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gl3bh0jq