heatr3

Ensembl ID:
ENSDARG00000036076
ZFIN ID:
ZDB-GENE-040426-1876
Description:
HEAT repeat-containing protein 3 [Source:RefSeq peptide;Acc:NP_957183]
Human Orthologue:
HEATR3
Human Description:
HEAT repeat containing 3 [Source:HGNC Symbol;Acc:26087]
Mouse Orthologue:
Heatr3
Mouse Description:
HEAT repeat containing 3 Gene [Source:MGI Symbol;Acc:MGI:2444491]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34126 Nonsense Mutation detected in F1 DNA During 2016
sa1194 Nonsense Available for shipment Available now
sa14921 Nonsense Available for shipment Available now
sa34125 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa34126
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052368 Nonsense 71 682 2 15

The following transcripts of ENSDARG00000036076 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 39309682)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37646322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGTATGCCTGTGCCAGTATCTCTCGGATTGTCCAGGAGAATCAAACCT[T/G]ACCAGGATTCCTCCAAAGAGATGCAGTGAGGAAAATTGGACCTTTATTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1194
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052368 Nonsense 187 682 5 15

The following transcripts of ENSDARG00000036076 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 39304725)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37641365
KASP Assay ID:
554-1103.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACAGCAGTGTCCGTGTTTAACAAGGCTGGACTTGTGGATGTTCTTCTA[C/T]AATGTCTACAAAAGCACCCTCAGAATATGGAGCTGGCAATATCAGCAGGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa14921
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052368 Nonsense 356 682 8 15

The following transcripts of ENSDARG00000036076 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 39297838)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37634478
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCTCARCAAATACTTTTNGTTTGTGTGCCTGTGGGTTTCTAGCGAGAC[C/T]RACTGGAGTTGCGAGAGGCYAAAGCACTGCTGTCAGCACAGCAAACGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052368 Nonsense 449 682 10 15

The following transcripts of ENSDARG00000036076 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 39296791)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37633431
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTATTTCAGGTGTTGAAGAAGGCTGAGTTCCCTAGTGCTGCTGCACTT[G/T]AGCTCTGTAGCAAAGATTCTTCTTGGAAATGCCTCTTGAAAAAGTAATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link