cebpa

Ensembl ID:
ENSDARG00000036074
ZFIN ID:
ZDB-GENE-020111-2
Description:
CCAAT/enhancer-binding protein alpha [Source:RefSeq peptide;Acc:NP_571960]
Human Orthologue:
CEBPA
Human Description:
CCAAT/enhancer binding protein (C/EBP), alpha [Source:HGNC Symbol;Acc:1833]
Mouse Orthologue:
Cebpa
Mouse Description:
CCAAT/enhancer binding protein (C/EBP), alpha Gene [Source:MGI Symbol;Acc:MGI:99480]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18352 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18352
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052366 Nonsense 243 288 1 1
Genomic Location:
Chromosome 7 (position 39479027)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCGCAAGAGTCGGGACAAGGCGAAAATGCGCAATGTGGAGACGCAACAA[A/T]AAGTGATCGAGTTATCGGCGGATAACGMTAGACTGCGCAAGAGGGTGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s2h2abl3