cebpg

Ensembl ID:
ENSDARG00000036073
ZFIN ID:
ZDB-GENE-020111-5
Description:
CCAAT/enhancer-binding protein gamma [Source:RefSeq peptide;Acc:NP_571961]
Human Orthologue:
CEBPG
Human Description:
CCAAT/enhancer binding protein (C/EBP), gamma [Source:HGNC Symbol;Acc:1837]
Mouse Orthologue:
Cebpg
Mouse Description:
CCAAT/enhancer binding protein (C/EBP), gamma Gene [Source:MGI Symbol;Acc:MGI:104982]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa542 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa542
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052365 Nonsense 153 163 3 3
ENSDART00000131387 Nonsense 153 158 3 3
Genomic Location:
Chromosome 7 (position 39485695)
KASP Assay ID:
554-0452.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGACAACGTGCAACCACCTGCTTCTGGTGGAGGCCCTGGAGACCTTTG[C/A]AACAACAACAGCGGCAGTAACAGCAGCCAGTGAGGGTTCGTTTGCAATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/75y2yvoo